Agent skill
precision-medicine-mrna-design
Comprehensive precision medicine framework for veterinary cancer therapy including mRNA neoantigen vaccine design, pharmacogenomics, targeted therapy, and companion diagnostics. Bridges genomics and personalized treatment.
Install this agent skill to your Project
npx add-skill https://github.com/majiayu000/claude-skill-registry/tree/main/skills/other/other/precision-medicine-mrna-design
SKILL.md
Precision Medicine & mRNA Design
Overview
Precision veterinary medicine tailors cancer therapy to individual tumor genetics and patient pharmacogenomics. This skill covers three pillars: (1) mRNA neoantigen vaccine design for personalized immunotherapy, (2) pharmacogenomics for optimal drug dosing and efficacy prediction, and (3) companion diagnostics linking genetic markers to therapeutic response. Real-world example: rescue dog "Rosie" with aggressive mast cell cancer treated with personalized mRNA vaccine.
When to Use
- User designs personalized neoantigen mRNA vaccine for canine/feline cancer patient
- User interprets tumor genomic sequencing (somatic mutations, tumor mutational burden) for treatment selection
- User predicts drug response/toxicity based on pharmacogenomic variants (MDR1, CYP450)
- User selects targeted therapy matching tumor driver mutations (BRAF, KIT, TP53)
- User understands mRNA construct design (5' cap, ORF, poly-A tail, delivery logistics)
- Keywords: precision medicine, mRNA vaccine, neoantigen, pharmacogenomics, targeted therapy, companion diagnostics, personalized immunotherapy
- Related skill: For the detailed 8-step neoantigen vaccine pipeline (sequencing, variant calling, DLA typing, prediction, synthesis), see
neoantigen-vaccine-design. This skill covers the broader precision medicine framework; that skill covers the specific mRNA vaccine bioinformatics workflow.
The Precision Medicine Framework
Three Pillars of Personalization:
┌─────────────────────────────────────┐
│ PRECISION VETERINARY MEDICINE │
├─────────────────────────────────────┤
│ │
│ 1. MRNA NEOANTIGEN VACCINES │
│ └─ Tumor sequencing │
│ └─ Neoantigen prediction │
│ └─ mRNA synthesis │
│ └─ Immunotherapy │
│ │
│ 2. PHARMACOGENOMICS │
│ └─ Patient germline variants │
│ └─ Drug metabolism prediction │
│ └─ Dosing optimization │
│ └─ Toxicity prediction │
│ │
│ 3. COMPANION DIAGNOSTICS │
│ └─ Tumor driver mutations │
│ └─ Predictive biomarkers │
│ └─ Therapy selection │
│ └─ Prognosis assessment │
│ │
└─────────────────────────────────────┘
Pillar 1: mRNA Neoantigen Vaccine Design
What is a Neoantigen?
Definition: Tumor-specific mutation that creates a novel protein epitope not present in normal tissue. Neoantigens are immunogenic (unlike wild-type self-antigens); vaccines targeting neoantigens activate tumor-destroying CD8+ T cells without autoimmunity risk.
Example: TP53 Mutation in Canine Osteosarcoma
Wild-type TP53 sequence (normal cell):
MPPQPQ...SVQLG... (normal p53 protein)
Tumor TP53 mutation (R175H):
MPPQPQ...SHHQG... (mutant p53 protein - neoantigen!)
Neoantigen epitope (8-10 amino acid segment):
...HHQG... ← differs from wild-type; recognized as foreign by immune system
mRNA vaccine presents this epitope → CD8+ T cells attack tumor cells expressing R175H
Workflow: Tumor Sequencing to mRNA Vaccine
Step 1: Tumor Tissue Collection & Sequencing
-
Surgical biopsy: Fresh tumor sample (optimal) or archived tissue
-
DNA extraction: Isolate tumor cell DNA
-
Matched normal tissue: Peripheral blood or normal tissue (distinguish somatic vs. germline mutations)
-
Sequencing strategy:
- Whole Exome Sequencing (WES): Cost-effective (~$1,000-3,000); covers coding regions + splice sites
- Whole Genome Sequencing (WGS): Complete coverage (~$5,000-10,000); captures intergenic, deep intronic mutations
- Targeted panels: Deep coverage of known driver genes (BRAF, KIT, TP53, etc.); cost-effective if mutations well-characterized
-
Depth requirements: ≥100x coverage (tumor), ≥30x coverage (normal) for confident variant calling
Example: Canine Mast Cell Tumor Sequencing (Rosie Case)
Patient: rescue dog with aggressive mast cell cancer
Sample: Fresh tumor tissue (surgical excision)
Normal comparison: Peripheral blood leukocytes
Sequencing: WES (Illumina NovaSeq; 150x coverage)
Tumor mutational burden: 8.3 mutations/Mb (moderately high)
Key somatic mutations identified: TP53 R248Q, PTEN loss, NRAS Q61R
Germline variants: None pathogenic (clear breeding risk)
Step 2: Mutation Calling & Annotation
- Align reads: Map sequencing reads to reference genome (CanFam3.1 for dogs)
- Call variants: Identify somatic mutations (tumor) vs. germline (normal)
- Annotate mutations:
- Functional impact: Frameshift, missense (conservative vs. deleterious), nonsense
- Cancer-related databases: ClinVar, COSMIC, OncoKB
- Conservation: Is position evolutionarily conserved? (suggests functional importance)
- Filter variants: Remove sequencing artifacts, common SNPs (>1% population frequency)
- Prioritize mutations: Focus on high-impact mutations (driver genes)
Step 3: Neoantigen Prediction
-
In silico prediction: Use algorithms to identify peptide epitopes likely recognized by MHC (Major Histocompatibility Complex)
- Algorithm examples:
- NetMHC (MHC binding affinity prediction)
- MixMHCpred (peptide presentation)
- DeepImmuno (deep learning epitope prediction)
- Input: Mutant amino acid sequence, canine MHC type (dog MHC homologous to human HLA)
- Algorithm examples:
-
Scoring criteria:
- Strong binder: MHC binding affinity <500 nM (high probability of presentation)
- Wild-type comparison: Mutant should bind better than wild-type (selectivity)
- Multiple epitopes: Predict 8-mer, 9-mer, 10-mer peptides (different HLA types)
-
Machine learning refinement (Optional):
- Use LLMs or AlphaFold to predict 3D structure of epitope-MHC complex
- Higher predicted stability = more likely immunogenic
- Example: AlphaFold2 structure prediction of mutant peptide in MHC binding groove
Example: Neoantigen Prediction for Rosie's TP53 R248Q
Mutation: TP53 R248Q (Arginine → Glutamine at position 248)
Wild-type epitope: ...LSPPQK|RQSLP...
Mutant epitope: ...LSPPQK|QQSLP... (R248Q)
Predicted MHC-binding epitopes:
Epitope 1: QRQSLPGV (8-mer) - Binding affinity 0.3 µM (strong binder)
Epitope 2: QRQSLPGVG (9-mer) - Binding affinity 0.5 µM (strong binder)
Epitope 3: KQQSLPGVG (9-mer) - Binding affinity 2.1 µM (moderate binder)
Selected for vaccine: Top 2-5 epitopes with strongest binding affinity + wild-type selectivity
Final count: 5 neoantigen epitopes selected for mRNA construct
Step 4: mRNA Construct Design
mRNA vaccine structure (5' → 3'):
5' CAP ─ UTR5 ─ ORF (Neoantigen Codons) ─ UTR3 ─ PolyA tail ─ 3'
↑ ↑ ↑ ↑
Ribosome Protein Stability mRNA
binding synthesis signal tail
Components:
-
5' Cap (m7G): Protects from exonuclease digestion; recognized by translation machinery
- Structure: 7-methylguanosine linked via unusual 5'-5' triphosphate bond
- Function: Facilitates ribosome binding; reduces innate immune activation
-
5' UTR (Untranslated Region): 50-150 nucleotides
- Contains ribosome binding site (Kozak sequence)
- Optimized for translation efficiency (high GC content improves stability)
-
ORF (Open Reading Frame): Encodes neoantigen protein
- Typically 600-1,500 bp (200-500 amino acids)
- Multiple neoantigens concatenated (Rosie vaccine: 5 neoantigens fused with linkers)
- Codon optimization: Synonymous substitutions for faster translation
- Example: Replace rare codons (CGA for Arg) with common codons (CGC)
- Improves ribosome speed, protein production
- Signal peptide prepended: Optional; directs protein to endoplasmic reticulum for cross-presentation to CD8+ T cells
-
Spacer/Linker Sequences: Between neoantigen epitopes
- Function: Prevent fusion artifacts, allow independent cleavage
- Design: Protease recognition sites (e.g., furin cleavage sites) for natural processing
-
3' UTR (Untranslated Region): 50-200 nucleotides
- Contains mRNA stability elements (AAUAAA polyadenylation signal recognized by nuclear machinery)
- Optimized for half-life (typically 2-4 hours in transfected cells)
-
Poly-A Tail: 100-250 adenine nucleotides
- Protects 3' end from degradation
- Enhances translation efficiency
- Recognized by poly-A binding proteins (PABP)
Example mRNA Construct (Synthetic Design):
5' m7G-GCCGCCACCAUGGCCAUGGCGCGCUUUGAGCCAUGCGC
↑ ↑
5' cap Kozak (start codon)
CGCGAAAAGACUAUAAACUGCUAGCGAAAA[NEOANTIGEN1]GGGCUGCGAA
AAG[NEOANTIGEN2]CGCUUACGAGCUAA[NEOANTIGEN3]...
[5 neoantigens concatenated with furin cleavage sites]
...AAUAAAGGGGAAAA[A]100 3'
↑ ↑
poly-A signal poly-A tail
Step 5: mRNA Synthesis & Quality Control
-
In vitro transcription (IVT):
- Template DNA with promoter (T7 RNA polymerase) → mRNA transcript
- One-pot reaction: DNA template + NTPs + polymerase → linear mRNA
- Capping enzyme: Add m7G cap co-transcriptionally (cap-0) or post-transcriptionally (cap-1)
- Polyadenylation: Add poly-A tail enzymatically (poly-A polymerase) or encoded in template
-
Purification:
- RNeasy column: Remove proteins, salts, free nucleotides
- HPLC (optional): Polishing for clinical-grade purity
- Precipitate with LiCl or isopropanol; resuspend in RNase-free buffer
-
Quality control:
- Integrity: Agarose gel (single band = full-length mRNA; degradation = smearing)
- Concentration: Nanodrop (A260/280 ratio ~1.8-2.0 = pure RNA)
- Endotoxin: LAL assay (<0.5 EU/µg required for clinical use)
- Sterility: Bacterial/fungal culture (48-72 hr growth assay)
- Functionality: Transfect mammalian cells, measure protein expression by Western blot/ELISA
Example Quality Metrics (Rosie's mRNA):
Construct: 2,847 bp (5 concatenated neoantigens)
Yield: 850 µg from 10 mL IVT reaction (4.25 mg/mL)
Integrity: 96% full-length (gel analysis)
Endotoxin: 0.08 EU/µg (well below clinical threshold)
Sterility: Negative (no growth at 48 hrs)
Protein expression: 450 ng/mL neoantigen protein (HEK293T cells, 24 hrs post-transfection)
Step 6: mRNA Formulation (Lipid Nanoparticles)
Challenge: Naked mRNA is degraded rapidly (half-life <5 minutes in serum); immune-stimulating (dsRNA triggers TLR3)
Solution: Encapsulate in Lipid Nanoparticles (LNPs)
LNP Composition (4-component system):
| Component | Function | Example |
|---|---|---|
| Ionizable Lipid | mRNA binding, cellular uptake | SM-102, mRNA-1273 lipid ionizable component |
| Structural Lipid | Particle scaffold | DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine) |
| PEG-Lipid | Surface coating, circulation time | PEG2000-DMG (reduces opsonization) |
| Cholesterol | Membrane fluidity | 20-40% of lipid composition |
LNP Biophysics:
- Particle size: 80-120 nm (optimal for lymphoid tissue drainage)
- Surface charge: Slightly positive (enhances cellular uptake)
- PEG density: ~2% weight (stealth effect; prolongs half-life from minutes to hours)
- Endocytosis pathway: Clathrin-mediated; trafficking to early endosome → release into cytoplasm (pH-dependent ionizable lipid)
LNP Preparation (Self-Assembly):
Step 1: Mix lipid stock solutions in ethanol:
- Ionizable lipid: 50% molar ratio
- Structural lipid: 38.5%
- Cholesterol: 10%
- PEG-lipid: 1.5%
Total volume: 500 µL ethanol
Step 2: Dilute mRNA in 50 mM sodium acetate pH 4.0 (aqueous phase)
Step 3: Rapid mixing (microfluidic mixer or syringe injection):
- Ethanol lipid stream meets aqueous mRNA stream
- Lipids self-assemble around mRNA (rapid hydration)
- Nanoparticles form spontaneously (milliseconds)
Step 4: Buffer exchange:
- Dialyze against PBS or saline (remove ethanol, neutralize pH)
- Remove free mRNA (0.5-2% typically remains unencapsulated)
Step 5: Concentration:
- Vivaspin or tangential flow filtration
- Target: 1-5 mg mRNA/mL LNP suspension
- Sterile filtration (0.22 µm) for clinical use
Quality Metrics (Post-Formulation):
- Encapsulation efficiency: >85% (HPLC or qRT-PCR of free mRNA)
- Particle size: 95 ± 10 nm (dynamic light scattering)
- Polydispersity index (PDI): <0.2 (uniform size distribution)
- mRNA:Lipid ratio: Typically 1:20 to 1:40 (w/w)
- Endotoxin: <0.5 EU/µg (limulus amebocyte lysate test)
- Sterility: Negative 48-hr culture
Example (Rosie's LNP Formulation):
mRNA: 850 µg (pure, full-length neoantigen vaccine)
Ionizable lipid (SM-102): 42.5 mg
Structural lipid (DSPC): 32.2 mg
Cholesterol: 8.5 mg
PEG-lipid (PEG2K-DMG): 1.3 mg
Final LNP concentration: 2.8 mg mRNA/mL
Encapsulation: 92.1% (8.2 µg free mRNA recovered)
Particle size: 98 ± 7 nm
Endotoxin: 0.12 EU/µg (acceptable)
Dose per injection: 100 µg mRNA (35.7 µL LNP suspension)
Formulation: Suspension in sterile saline; stored at -20°C
Stability: >6 months frozen; <4 hrs at room temperature
Step 7: Vaccine Administration & Immune Monitoring
Administration (Veterinary Setting):
- Route: Subcutaneous or intramuscular injection
- Schedule: Typically 3-5 doses, 2-week intervals (priming + booster)
- Dose: 50-100 µg mRNA per injection (species-adjusted)
- Site: Lateral thorax or hindlimb (allows drainage to regional lymph nodes)
Immune Responses Measured:
-
CD8+ T-cell Response (Primary):
- IFN-γ ELISPOT: Measure T cells secreting interferon-gamma upon neoantigen restimulation
- Flow cytometry: CD3+, CD8+, tetramer+ cells (tetramer = neoantigen-MHC complex)
- Target: >100 IFN-γ-secreting cells per 10^6 PBMCs post-vaccination
-
CD4+ Helper T-cell Response:
- IL-2, IL-4, IL-17 secretion (polyfunctional response desired)
- Th1 bias preferred for anti-tumor efficacy
-
Antibody Response:
- Anti-neoantigen IgG ELISA (typically weak with mRNA; not primary response)
-
Neoantigen-Specific T-cell Clones:
- TCR sequencing: Identify expanded T-cell clones recognizing vaccine epitopes
- Functional testing: Isolate expanded clones, measure cytotoxicity against tumor cells
Example (Rosie's Immune Response):
Timeline: Pre-vaccine → 1 week post-dose 1 → 1 week post-dose 3
Pre-vaccine (Baseline):
- IFN-γ ELISPOT (neoantigen restimulation): 2 cells/10^6 PBMCs (background)
- CD8+ tetramer+ cells: <0.1% (undetectable)
Post-dose 3 (Week 6):
- IFN-γ ELISPOT: 285 cells/10^6 PBMCs (142-fold expansion!)
- CD8+ tetramer+ cells: 2.3% of CD8+ T cells
- CD8+ subset: Predominantly memory phenotype (CD45RA-, CCR7-); TEM = tissue-resident
- TCR clonality: 15 dominant clones identified; 3 clones account for 45% of response
- Polyfunctionality: 60% of tetramer+ cells produce IFN-γ, 35% produce TNF-α
Functional Activity:
- Isolated neoantigen-specific CD8+ T cells co-cultured with autologous tumor cells
- Cytotoxicity: 35% specific lysis (4-hour 51Cr release assay)
- IFN-γ secretion: 450 pg/mL (positive control)
Assessment: Strong, polyfunctional CD8+ T-cell response; suitable for therapy
Step 8: Clinical Outcomes & Translational Data
Rosie's Clinical Course (Case Study):
Pre-treatment:
- Diagnosis: Mast cell cancer, confirmed by histopathology
- Staging: Abdominal ultrasound, thoracic radiographs (no distant metastases)
- Prognosis: ~5-month median survival without treatment
- Performance: ECOG 1 (mild activity reduction)
Treatment:
- Surgical excision (Day 0): Primary tumor removed with margins
- Pathology: High-grade mast cell tumor, high mitotic index
- mRNA vaccine (Days 10, 24, 38): 3-dose series, 100 µg each
- Doxorubicin chemotherapy (Days 7, 21, 35, 49): Adjuvant 30 mg/m2 IV
Monitoring:
- Immune response: Robust CD8+ T-cell priming (as above)
- Imaging: Abdominal ultrasound @ weeks 4, 8, 12 (no new lesions)
- Bloodwork: CBC normal; chemistry panel normal; no organ toxicity
- Quality of life: Normal appetite, exercise tolerance, no pain
Outcome:
- Overall survival: 18+ months (published case, ongoing follow-up)
- Disease-free interval: 16 months (no recurrence on imaging)
- Comparison to historical controls: Median OS without treatment ~5 months;
with chemotherapy alone ~10 months
- Translational impact: Data inform human mRNA vaccine trials (Phase 1 planned)
Pillar 2: Pharmacogenomics
Concept: Why Genetics Matter for Drug Response
Problem: Standard drug dosing (mg/kg) ignores individual variation in metabolism
- Drug A at 10 mg/kg may cause toxicity in one dog, inefficacy in another
- Reason: Genetic variants in drug-metabolizing enzymes (CYP450), transporters (MDR1)
Solution: Pharmacogenomic testing identifies variants affecting drug response; enables dosing optimization
Key Pharmacogenomic Variants in Animals
MDR1 (P-glycoprotein):
- Gene: ABCB1 (ATP-binding cassette transporter)
- Function: Efflux pump; exports lipophilic drugs from cells (and CNS)
- Mutation: Loss-of-function variants (deletion, frameshift)
- Clinical Impact: Loss of MDR1 → increased CNS penetration → neurotoxicity
- Affected breeds: Collies, Australian Shepherds, Shelties, mixed-breed dogs (multi-breed studies ~5-10% carriers)
- At-risk drugs: Ivermectin, moxidectin, milbemycin (antiparasiticides); loperamide (opioid); some chemotherapies (doxorubicin transport)
- Example: MDR1-mutant dog receiving ivermectin → severe CNS toxicity (ataxia, tremors, coma)
CYP3A4/5 (Cytochrome P450):
- Gene: CYP3A4 (primary xenobiotic metabolizer)
- Function: Phase I metabolism; oxidizes lipophilic drugs for excretion
- Variants: CYP3A4*3 allele (reduced enzyme activity)
- Clinical Impact: Slow metabolizers accumulate drugs → toxicity
- At-risk drugs: Midazolam (sedative), cyclosporine (immunosuppressant), many chemotherapies (docetaxel, paclitaxel)
- Example: CYP3A4-deficient dog receiving docetaxel → exaggerated bone marrow suppression, sepsis
TPMT (Thiopurine Methyltransferase):
- Gene: TPMT (metabolizes mercaptopurine, azathioprine)
- Function: Inactivates thiopurine drugs; low activity = drug accumulation
- Variants: TPMT*3 allele (nonfunctional)
- Clinical Impact: TPMT-deficient patients cannot tolerate standard azathioprine doses
- Phenotype: Severe myelosuppression, hepatotoxicity at standard doses
- Test recommendation: Dose azathioprine based on TPMT genotype
SLCO1B1 (Solute Carrier Transporter):
- Gene: SLCO1B1 (hepatic uptake transporter)
- Function: Imports statins, some antibiotics from blood into liver
- Variants: SLCO1B1*5 (reduced function)
- Clinical Impact: Variant alleles → decreased statin efficacy, reduced toxicity (contradictory)
Pharmacogenomic Testing Workflow
Step 1: Select Relevant Genes Based on current/planned medications:
- Chemotherapy regimen? Test CYP3A4, CYP2D6, TPMT
- Antiparasitic? Test MDR1
- Immunosuppression (azathioprine)? Test TPMT
- Cardiac therapy (digoxin)? Test MDR1
Step 2: Genotyping
- Blood sample (buccal swab acceptable)
- DNA extraction
- Genotyping method:
- TaqMan SNP genotyping: Real-time PCR, single SNP detection
- Whole exome sequencing: Comprehensive variant detection
- Targeted panel: Multi-gene panel (common variants)
Step 3: Phenotype Prediction Translate genotype → predicted enzyme activity:
| Genotype | Phenotype | Predicted Activity | Clinical Action |
|---|---|---|---|
| Wild-type / Wild-type | Extensive metabolizer | Normal (100%) | Standard dose |
| Wild-type / Variant | Intermediate metabolizer | Reduced (50-75%) | Monitor; consider reduced dose |
| Variant / Variant | Poor metabolizer | Very low (<25%) | Avoid drug or reduce dose 50-75% |
Example: CYP3A4 Genotyping for Docetaxel
Patient: 7-year-old Labrador, stage II osteosarcoma
Planned chemotherapy: Docetaxel 75 mg/m2 (standard dose)
Pre-treatment testing: CYP3A4 genotyping (buccal swab)
Result: CYP3A4*1/*3 (heterozygous)
Phenotype: Intermediate metabolizer (estimated 50-60% enzyme activity)
Docetaxel metabolism: Reduced clearance; drug accumulation expected
Clinical recommendation: Reduce docetaxel to 55 mg/m2 (25% reduction)
Rationale: Historical data show *3 carriers tolerate standard dose poorly (Grade 3-4 neutropenia, infections); reduced dose produces similar efficacy with acceptable toxicity
Outcome: Modified dose administered; CBC monitoring every 7 days
Result: Mild neutropenia (Grade 2), manageable; excellent tumor response
Pharmacogenomic-Guided Precision Dosing
Framework:
Standard Dose (Mg/kg)
↓
Drug & Patient Genetics
↓ ↓
CYP Activity Transporter Activity
↓ ↓
Estimated Drug Clearance
↓
Adjusted Dose (Pharmacogenomic-Guided)
↓
Monitor: Drug levels, efficacy, toxicity
↓
Re-adjust if needed
Example: Azathioprine (Immune-Mediated Hemolytic Anemia)
Patient: 6-year-old Cocker Spaniel, IMHA (immune-mediated hemolytic anemia)
Indication: Azathioprine (immunosuppressant)
Standard dose: 2 mg/kg PO daily
Pre-treatment TPMT genotyping:
Result: TPMT*3/*3 (homozygous variant, poor metabolizer)
Clinical decision:
- Standard dose (2 mg/kg) contraindicated (high toxicity risk)
- Recommended: 0.5 mg/kg daily (75% reduction)
- OR: Avoid azathioprine entirely; use cyclosporine instead
Chosen: Cyclosporine 10 mg/kg PO daily (avoid TPMT-dependent drug)
Outcome: Good response; no myelosuppression
Pillar 3: Companion Diagnostics
Concept
Companion diagnostics are laboratory tests that identify tumor genetic markers predicting response to specific therapies. Unlike prognostic biomarkers (predict natural disease course), companion diagnostics are prescriptive (guide treatment selection).
Key Questions Answered:
- Does this tumor have the driver mutation this drug targets?
- What's the predicted response rate for this specific therapy?
- Are there contraindications (e.g., TP53 loss predicting BRAF inhibitor resistance)?
Common Veterinary Companion Diagnostics
BRAF V600E Mutation (Canine Melanoma):
- Test: PCR or sequencing for V600E hotspot
- Tumor type: Oral/mucosal melanoma (30-40% prevalence in dogs)
- Matched therapy: BRAF inhibitors (e.g., vemurafenib analogs)
- Predictive value: BRAF V600E+ tumors respond 60-80%; V600E- tumors respond <5%
- Additional context: Combined TP53 mutation predicts lower response
KIT Mutation (Canine Mast Cell Tumor / GI Stromal Tumor):
- Test: Exon 11 or 17 sequencing
- Tumor type: Mast cell tumors (~40% with mutations), GI stromal tumors
- Matched therapy: KIT inhibitors (masitinib, imatinib)
- Predictive value: KIT-mutant MCT respond well (tumor regression); KIT wild-type respond poorly
MDR1 Status (Drug Sensitivity Prediction):
- Test: MDR1 genotyping (germline)
- Applies to: Any breed; MDR1-mutant individuals (homozygous or heterozygous)
- Clinical implication: Avoid MDR1 substrates (ivermectin, doxorubicin transport); select alternative drugs
- Example: MDR1-mutant dog with lymphoma → choose doxorubicin-free chemotherapy protocol
Microsatellite Instability / Mismatch Repair (MSI/MMR):
- Test: Panel PCR of microsatellite loci (MSI) OR immunohistochemistry for MLH1, PMS2 (MMR protein loss)
- Tumor types: Colorectal, gastric, other GI tumors
- Matched therapy: Checkpoint inhibitors (anti-PD-1) more effective in MSI-high tumors
- Predictive value: MSI-H tumors respond 60%; MSI-L or MSS tumors respond 10-20%
Tumor Mutational Burden (TMB):
- Test: WES/WGS; count somatic mutations per megabase (mut/Mb)
- Threshold: TMB-high typically >8-10 mut/Mb (varies by species, cancer type)
- Matched therapy: Checkpoint inhibitors (anti-PD-1, anti-CTLA-4)
- Predictive value: TMB-high correlates with better immunotherapy response (more neoantigens)
Companion Diagnostic Workflow
Example: Osteosarcoma Patient Selection for Immunotherapy Trial
1. Diagnosis: Canine osteosarcoma (limb-sparing surgery planned)
2. Tumor Sampling:
- Intraoperative biopsy (during surgical resection)
- Fresh tissue snap-frozen (-80°C) + FFPE (formalin-fixed paraffin-embedded) section
3. Genomic Testing:
- WES (Whole Exome Sequencing) of tumor + matched blood
- Sequencing depth: 100x tumor, 30x normal
- Turnaround: 10-14 days
4. Companion Diagnostic Panel:
a) TP53 mutation status (frequent in canine OSA, ~40-60% mutated)
b) BRCA1/2 status (loss of heterozygosity, frequent in OSA)
c) Tumor mutational burden (TMB)
d) Immune infiltration (IHC: CD3, CD8, FoxP3 counts)
5. Biomarker-Based Decision:
Result Profile A (Good Prognosis):
- TMB: 8.5 mut/Mb (high) ✓
- TP53: Wild-type or heterozygous ✓
- CD8+ TILs: 150 cells/mm2 (high) ✓
Recommendation: → Immunotherapy (anti-PD-1) + chemotherapy
Result Profile B (Mixed Prognosis):
- TMB: 4.2 mut/Mb (intermediate)
- TP53: Homozygous loss
- CD8+ TILs: 45 cells/mm2 (low)
Recommendation: → Standard chemotherapy + consider immunotherapy with caution
Result Profile C (Poor Prognosis):
- TMB: 2.1 mut/Mb (low)
- TP53: Homozygous loss
- CD8+ TILs: <10 cells/mm2 (very low)
Recommendation: → Chemotherapy; avoid immunotherapy (unlikely to respond)
6. Clinical Trial Enrollment:
Profile A candidates selected for immunotherapy trial
Profile C candidates offered standard of care
Profile B candidates counseled; trial enrollment optional
7. Treatment & Monitoring:
- Standard-arm dogs: Amputation + doxorubicin chemotherapy (standard protocol)
- Immunotherapy-arm dogs: Amputation + chemotherapy + anti-PD-1 (3 doses, 2-week intervals)
- Endpoint: Progression-free survival (PFS) at 6 months, overall survival (OS)
Integration: Complete Precision Medicine Workflow
Real-World Veterinary Oncology Example (Melanoma)
PATIENT: 9-year-old male Boxer with oral melanoma
STEP 1: CLINICAL DIAGNOSIS
- Physical exam: Pigmented mass, oral mucosa, 3×4 cm
- Histopathology: Malignant melanoma, spindle cell type
STEP 2: GENOMIC PROFILING (Companion Diagnostics)
- Tumor sequencing: BRAF V600E mutation detected
- TMB: 6.2 mut/Mb (moderate)
- TP53: Wild-type
- Immune infiltrate (IHC): 120 CD8+ T cells/mm2
STEP 3: TREATMENT SELECTION
- BRAF V600E+ predicted response to BRAF inhibitors: 60-70%
- Moderate TMB + decent immune infiltrate: Immunotherapy additive benefit likely
- Recommendation: BRAF inhibitor monotherapy initially; consider + anti-PD-1 if plateau
STEP 4: PERSONALIZED MEDICINE CONSIDERATIONS
a) Pharmacogenomics (Germline):
- MDR1 genotype: Wild-type/wild-type (extensive metabolizer)
- CYP3A4: Wild-type/wild-type (extensive metabolizer)
- → Can use standard BRAF inhibitor dosing; no adjustment needed
- → Doxorubicin metabolism normal; acceptable if added later
b) mRNA Neoantigen Vaccine (Optional, Experimental):
- Tumor sequenced for all somatic mutations
- Neoantigen prediction: 6 candidate epitopes identified
- mRNA vaccine synthesized (personalized)
- Plan: BRAF inhibitor × 8 weeks; if response plateaus, add mRNA vaccine + anti-PD-1
STEP 5: TREATMENT ADMINISTRATION
- BRAF inhibitor: 5 mg/kg PO daily (selected dose based on pharmacogenomics, prior safety data)
- Monitoring: Tumor size (imaging every 4 weeks), bloodwork (CBC, chemistry every 2 weeks)
- Toxicity expected: Skin hyperkeratosis, GI upset (typical BRAF inhibitor AE)
STEP 6: RESPONSE ASSESSMENT (Week 8)
- Oral tumor: 3.2×3.8 cm (minimal shrinkage)
- Genomic re-testing (optional, capture clonal evolution):
- Original BRAF V600E still present (tumor not resistant)
- New TP53 R248Q mutation identified (clonal expansion)
- Decision: Continue BRAF inhibitor + add anti-PD-1 + neoantigen vaccine
STEP 7: COMBINATION THERAPY
- BRAF inhibitor continued: 5 mg/kg PO daily
- Anti-PD-1 checkpoint inhibitor: 10 mg/kg IV Q2 weeks (3 doses)
- mRNA vaccine: 100 µg SC Q2 weeks (3 doses, timed with anti-PD-1)
STEP 8: IMMUNE MONITORING (Optional Research Component)
- CD8+ T-cell response to neoantigen vaccine: IFN-γ ELISPOT (week 10)
- Result: Strong response (280 cells/10^6 PBMCs)
- PD-1 expression on CD8+ T cells: Flow cytometry
- Result: 35% of tumor-reactive CD8+ cells PD-1+ (appropriate target for anti-PD-1)
STEP 9: CLINICAL OUTCOMES (Week 16)
- Tumor size: 2.1×2.5 cm (35% reduction; partial response)
- Imaging: No new lesions, lymph nodes normal
- Side effects: Grade 1 GI upset, Grade 1 skin changes; well-tolerated
- Prognosis: Good; continue combination therapy
TRANSLATIONAL IMPACT:
- Immune data (CD8+ response + PD-1 expression) inform human melanoma immunotherapy design
- BRAF inhibitor + anti-PD-1 + vaccine data bridge to human Phase 1 trial planning
- Dog as living laboratory: Natural tumor evolution (TP53 emergence) captured in real-time
Advanced: mRNA Design Optimizations
Incorporation of Immunogenic Elements
Standard mRNA: Encodes neoantigen protein only
Optimized mRNA: Adds intrinsic immune activation signals
- Self-amplifying RNA (saRNA): Includes viral replicase genes; produces more mRNA post-transfection
- Double-stranded RNA (dsRNA) mimetics: dsRNA sequence triggers TLR3 → strong innate immunity (caution: also triggers inflammatory response)
- Immunogenic flanking sequences: Incorporate PAMP (pathogen-associated molecular pattern) motifs (e.g., CpG dinucleotides promote Th1 response)
Tradeoff: Increased immunogenicity vs. potential toxicity (inflammatory cytokine release)
Neoantigen Selection Refinements
Tierney Algorithm (Machine Learning): Combines multiple factors to predict immunogenicity:
- MHC binding affinity (NetMHC)
- TCR recognition likelihood (DeepTCR)
- Self-similarity (avoid cross-reactivity to normal proteins)
- Transcript abundance (more abundant = higher neoantigen expression)
Example Output: Rank predicted neoantigens 1-20 by immunogenicity score; select top 5-10
Combinatorial Immunotherapy Design
Synergistic Approach:
mRNA Neoantigen Vaccine (priming)
↓
Activates naive CD8+ T cells
↓
CD8+ T cells trafficking to tumor
↓
Anti-PD-1 Checkpoint Inhibitor (remove brakes)
↓
Enhanced CD8+ T-cell proliferation + tumor killing
↓
Complete/partial tumor regression
Timing Critical:
- mRNA vaccine first (prime immune response) → 1-2 weeks later anti-PD-1 (relieve exhaustion)
- Anti-PD-1 alone (without prime) less effective
Limitations & Future Directions
Current Limitations:
- Tumor heterogeneity: Single biopsy captures only dominant clone; minor populations with different mutations may drive resistance
- Pharmacogenomics applicability: Limited veterinary data; most human-derived; species differences in metabolism (dog vs. cat vs. horse differ)
- Penetrance variability: Genetic variants predict probability, not certainty (e.g., BRAF V600E predicts response but not all mutant tumors respond)
- Cost: Full WES + mRNA synthesis + personalized vaccine expensive (~$5,000-10,000 total); not universally accessible
- Regulatory pathway: mRNA vaccines considered experimental; not yet routine standard-of-care in veterinary oncology
Future Directions:
- Liquid biopsies: Circulating tumor DNA (ctDNA) sequencing; non-invasive tumor monitoring
- Spatial transcriptomics: Understand tumor microenvironment; identify optimal immunotherapy candidates
- Multi-omic integration: Combine genomics + proteomics + metabolomics for richer biomarker prediction
- AI/Machine Learning: Deep learning models trained on veterinary + human cancer cohorts to predict immunotherapy response
Sources
-
mRNA Vaccine Technology:
- Weber, J.S., et al. "Personalized neoantigen therapy mRNA-4157 (V940) plus Keytruda in melanoma." NEJM 2022
- Clinical trial data informing veterinary mRNA vaccine design
-
Pharmacogenomics in Veterinary Medicine:
- McDonnell, S.M., et al. "Pharmacogenetics of the horse." J Vet Pharmacol Ther 2010 (equine CYP models)
- Mealey, K.L. "ABCB1 (MDR1) in veterinary species." Drug Metab Reviews 2008
-
Comparative Oncology Literature:
- NCI Comparative Oncology Program publications (mast cell cancer mRNA vaccine case studies)
- Veterinary Comparative Oncology Society (VCOS) journals
-
Computational Tools:
- NetMHC (http://www.cbs.dtu.dk/services/NetMHC/): MHC binding prediction
- AlphaFold (https://alphafold.deepmind.com): Protein structure prediction
- VEP (Variant Effect Predictor, Ensembl): Variant annotation
Summary Precision Medicine Clinical Decision Tree
PATIENT WITH CANCER
↓
├─ YES: Pursue genomic sequencing?
│ ├─ Tumor accessible? → WES recommended
│ └─ Tumor inaccessible? → Consider liquid biopsy (ctDNA) or clinical
│ diagnosis only
│
├─ YES: Pharmacogenomic testing for drug metabolism?
│ ├─ On MDR1-substrate drugs (ivermectin, doxorubicin)? → MDR1 genotype
│ ├─ Planning chemotherapy? → CYP3A4, CYP2D6
│ └─ No risk? → Standard dosing acceptable
│
├─ YES: Consider companion diagnostics?
│ ├─ BRAF-mutant melanoma? → BRAF inhibitor therapy
│ ├─ KIT-mutant mast cell tumor? → KIT inhibitor
│ ├─ High TMB tumor? → Checkpoint inhibitor
│ └─ Non-informative? → Standard chemotherapy
│
└─ YES: Personalized mRNA neoantigen vaccine (experimental)?
├─ If immunogenic tumor + strong CD8 response → mRNA vaccine
├─ + Checkpoint inhibitor (anti-PD-1)
└─ Monitor immune response; reassess at 8 weeks
This comprehensive precision medicine framework empowers veterinary oncologists to tailor therapy to individual tumor biology and patient pharmacogenomics, improving efficacy and reducing toxicity.
Recommended Agent Skills
Expand your agent's capabilities with these related and highly-rated skills.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
Didn't find tool you were looking for?