Agent skill

crispr-prediction

Stars 163
Forks 31

Install this agent skill to your Project

npx add-skill https://github.com/majiayu000/claude-skill-registry/tree/main/skills/data/crispr-prediction

SKILL.md

---name: crispr-offtarget-predictor description: Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis. license: MIT metadata: author: BioKernel Team version: "1.0.0" compatibility:

  • system: Python 3.9+ allowed-tools:
  • run_shell_command

keywords:

  • crispr-prediction
  • automation
  • biomedical measurable_outcome: execute task with >95% success rate. ---"

CRISPR Off-Target Predictor

This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.

When to Use This Skill

  • Designing new CRISPR experiments.
  • Validating sgRNA specificity before synthesis.
  • Analyzing potential safety risks in gene editing protocols.

Core Capabilities

  1. Mismatch Scoring: Calculates mismatch penalties for potential sites.
  2. PAM Validation: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
  3. Risk Assessment: Categorizes off-targets as Low, Medium, or High risk.

Workflow

  1. Input: sgRNA sequence (20nt) and PAM (e.g., NGG).
  2. Analysis: Scans a reference library (mocked for this version) for similar sequences.
  3. Output: List of potential off-targets with locations and risk scores.

Example Usage

User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."

Agent Action:

bash
python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG

Didn't find tool you were looking for?

Be as detailed as possible for better results