Agent skill
crispr-prediction
Install this agent skill to your Project
npx add-skill https://github.com/majiayu000/claude-skill-registry/tree/main/skills/other/crispr-prediction
SKILL.md
---name: crispr-offtarget-predictor description: Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis. license: MIT metadata: author: BioKernel Team version: "1.0.0" compatibility:
- system: Python 3.9+ allowed-tools:
- run_shell_command
keywords:
- crispr-prediction
- automation
- biomedical measurable_outcome: execute task with >95% success rate. ---"
CRISPR Off-Target Predictor
This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.
When to Use This Skill
- Designing new CRISPR experiments.
- Validating sgRNA specificity before synthesis.
- Analyzing potential safety risks in gene editing protocols.
Core Capabilities
- Mismatch Scoring: Calculates mismatch penalties for potential sites.
- PAM Validation: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
- Risk Assessment: Categorizes off-targets as Low, Medium, or High risk.
Workflow
- Input: sgRNA sequence (20nt) and PAM (e.g., NGG).
- Analysis: Scans a reference library (mocked for this version) for similar sequences.
- Output: List of potential off-targets with locations and risk scores.
Example Usage
User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."
Agent Action:
python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG
Recommended Agent Skills
Expand your agent's capabilities with these related and highly-rated skills.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
Didn't find tool you were looking for?