Agent skill
crispr-design-agent
A specialized tool for designing efficient and specific gRNA sequences for CRISPR-Cas9 experiments.
Install this agent skill to your Project
npx add-skill https://github.com/majiayu000/claude-skill-registry/tree/main/skills/other/crispr-design-agent
Metadata
Additional technical details for this skill
- author
- AI Group
- version
- 1.0.0
SKILL.md
CRISPR Design Agent
The CRISPR Design Agent automates the selection of guide RNAs (gRNAs) for gene editing. It scans DNA sequences for PAM sites, extracts spacers, and scores them based on efficiency rules (GC content, homopolymers).
When to Use This Skill
- When designing a CRISPR knockout or knock-in experiment.
- To find all valid Cas9 target sites in a given DNA sequence.
- To filter gRNAs by efficiency scores.
Core Capabilities
- Target Discovery: Identifies NGG PAM sites.
- Efficiency Scoring: Calculates scores based on GC content and sequence features.
- Filtering: Sorts guides by predicted efficacy.
Workflow
- Input: Provide a DNA sequence (raw string or FASTA file) and target gene name.
- Process: The agent scans the sequence and applies scoring logic.
- Output: Returns a ranked list of gRNA sequences with coordinates and scores.
Example Usage
User: "Find gRNAs for this sequence: ATCG..."
Agent Action:
python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
--sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
--output guides.json
Recommended Agent Skills
Expand your agent's capabilities with these related and highly-rated skills.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
Didn't find tool you were looking for?