Agent skill

crispr-design-agent

A specialized tool for designing efficient and specific gRNA sequences for CRISPR-Cas9 experiments.

Stars 163
Forks 31

Install this agent skill to your Project

npx add-skill https://github.com/majiayu000/claude-skill-registry/tree/main/skills/other/crispr-design-agent

Metadata

Additional technical details for this skill

author
AI Group
version
1.0.0

SKILL.md

CRISPR Design Agent

The CRISPR Design Agent automates the selection of guide RNAs (gRNAs) for gene editing. It scans DNA sequences for PAM sites, extracts spacers, and scores them based on efficiency rules (GC content, homopolymers).

When to Use This Skill

  • When designing a CRISPR knockout or knock-in experiment.
  • To find all valid Cas9 target sites in a given DNA sequence.
  • To filter gRNAs by efficiency scores.

Core Capabilities

  1. Target Discovery: Identifies NGG PAM sites.
  2. Efficiency Scoring: Calculates scores based on GC content and sequence features.
  3. Filtering: Sorts guides by predicted efficacy.

Workflow

  1. Input: Provide a DNA sequence (raw string or FASTA file) and target gene name.
  2. Process: The agent scans the sequence and applies scoring logic.
  3. Output: Returns a ranked list of gRNA sequences with coordinates and scores.

Example Usage

User: "Find gRNAs for this sequence: ATCG..."

Agent Action:

bash
python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
    --sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
    --output guides.json

Expand your agent's capabilities with these related and highly-rated skills.

Didn't find tool you were looking for?

Be as detailed as possible for better results