Agent skill
bio-crispr-screens-library-design
CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
Install this agent skill to your Project
npx add-skill https://github.com/majiayu000/claude-skill-registry/tree/main/skills/other/library-design-gptomics-bioskills-2
SKILL.md
Library Design
sgRNA Selection Criteria
import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq
def score_sgrna(sequence, pam='NGG'):
'''Score sgRNA based on multiple criteria.'''
scores = {}
gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2
if len(sequence) >= 4:
has_poly_t = 'TTTT' in sequence
scores['poly_t'] = 0 if has_poly_t else 1
starts_with_g = sequence.startswith('G')
scores['start_g'] = 1 if starts_with_g else 0.5
scores['length'] = 1 if len(sequence) == 20 else 0.8
overall = np.mean(list(scores.values()))
return overall, scores
def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
'''Design sgRNAs targeting a gene.'''
candidates = []
pam_pattern = pam.replace('N', '[ACGT]')
import re
for strand in ['+', '-']:
seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())
for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
sgrna = match.group(1)
position = match.start()
if strand == '-':
position = len(seq) - position - 23
score, details = score_sgrna(sgrna)
candidates.append({
'sequence': sgrna,
'pam': match.group(2),
'strand': strand,
'position': position,
'score': score,
'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
**details
})
candidates_df = pd.DataFrame(candidates)
candidates_df = candidates_df.sort_values('score', ascending=False)
return candidates_df.head(n_guides)
gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])
Library Composition
def design_library(gene_list, guides_per_gene=4, include_controls=True):
'''Design complete library for gene list.'''
library = []
for gene in gene_list:
gene_data = get_gene_sequence(gene)
guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)
for idx, guide in guides.iterrows():
library.append({
'gene': gene,
'gene_id': gene_data.get('ensembl_id', ''),
'guide_number': idx + 1,
'sequence': guide['sequence'],
'pam': guide['pam'],
'position': guide['position'],
'strand': guide['strand'],
'score': guide['score'],
'type': 'targeting'
})
if include_controls:
controls = design_control_guides()
library.extend(controls)
return pd.DataFrame(library)
def get_gene_sequence(gene_name):
'''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
return {
'sequence': 'ATGC' * 250,
'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
}
genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')
Control Guide Design
def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
'''Design control guides for library.'''
controls = []
for i in range(n_nontargeting):
sequence = generate_nontargeting_sequence()
controls.append({
'gene': f'NonTargeting_{i+1}',
'gene_id': '',
'guide_number': 1,
'sequence': sequence,
'pam': 'NGG',
'position': -1,
'strand': '',
'score': 0,
'type': 'non-targeting'
})
essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
for gene in essential_genes[:n_essential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'essential-control'
})
nonessential_genes = ['AAVS1', 'ROSA26']
for gene in nonessential_genes[:n_nonessential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'safe-harbor-control'
})
return controls
def generate_nontargeting_sequence(length=20):
'''Generate random non-targeting sequence.'''
while True:
seq = ''.join(np.random.choice(['A', 'C', 'G', 'T'], length))
gc = (seq.count('G') + seq.count('C')) / length
if 0.4 <= gc <= 0.6 and 'TTTT' not in seq:
return seq
def get_validated_guide(gene):
'''Get validated guide sequence for control gene.'''
validated = {
'RPS3': 'GAGCTTCTTCAGCAGCATGG',
'RPL11': 'GAAACAGGGCATCATCTACG',
'EIF3A': 'GTGCAAGAGGATGATGACAA',
'AAVS1': 'GGGGCCACTAGGGACAGGAT',
'ROSA26': 'GAAGATGGGCGGGAGTCTTC'
}
return validated.get(gene, generate_nontargeting_sequence())
Off-Target Analysis
def check_offtargets(guide_sequence, genome_index, max_mismatches=3):
'''Check for potential off-target sites.'''
from subprocess import run
import tempfile
with tempfile.NamedTemporaryFile(mode='w', suffix='.fa', delete=False) as f:
f.write(f'>guide\n{guide_sequence}\n')
query_file = f.name
result = run(
['bowtie', '-a', '-n', str(max_mismatches), '-l', '20', genome_index, '-f', query_file],
capture_output=True, text=True
)
offtargets = []
for line in result.stdout.strip().split('\n'):
if line:
fields = line.split('\t')
offtargets.append({
'chromosome': fields[2],
'position': int(fields[3]),
'strand': fields[1],
'mismatches': int(fields[7]) if len(fields) > 7 else 0
})
return offtargets
def filter_by_offtargets(library_df, genome_index, max_offtargets=10):
'''Filter library to remove guides with too many off-targets.'''
filtered = []
for _, guide in library_df.iterrows():
offtargets = check_offtargets(guide['sequence'], genome_index)
n_offtargets = len([ot for ot in offtargets if ot['mismatches'] <= 2])
if n_offtargets <= max_offtargets:
guide_dict = guide.to_dict()
guide_dict['n_offtargets'] = n_offtargets
filtered.append(guide_dict)
return pd.DataFrame(filtered)
Oligo Design for Cloning
def design_oligos(library_df, vector='lentiGuide-Puro'):
'''Design oligos for library cloning.'''
vector_specs = {
'lentiGuide-Puro': {
'forward_prefix': 'CACCG',
'forward_suffix': '',
'reverse_prefix': 'AAAC',
'reverse_suffix': 'C'
},
'pLKO': {
'forward_prefix': 'CCGG',
'forward_suffix': 'CTCGAG',
'reverse_prefix': 'AATTCTCGAG',
'reverse_suffix': ''
}
}
spec = vector_specs.get(vector, vector_specs['lentiGuide-Puro'])
oligos = []
for _, guide in library_df.iterrows():
seq = guide['sequence']
forward = spec['forward_prefix'] + seq + spec['forward_suffix']
reverse = spec['reverse_prefix'] + str(Seq(seq).reverse_complement()) + spec['reverse_suffix']
oligos.append({
'guide_id': f"{guide['gene']}_{guide['guide_number']}",
'gene': guide['gene'],
'guide_sequence': seq,
'forward_oligo': forward,
'reverse_oligo': reverse,
'type': guide.get('type', 'targeting')
})
return pd.DataFrame(oligos)
oligos = design_oligos(library)
oligos.to_csv('library_oligos.csv', index=False)
print(f'Designed {len(oligos)} oligo pairs')
Pool Design for Synthesis
def design_array_oligos(library_df, array_format='12K'):
'''Design array oligos for pooled synthesis.'''
formats = {
'12K': {'capacity': 12000, 'length': 200},
'92K': {'capacity': 92000, 'length': 150},
'244K': {'capacity': 244000, 'length': 60}
}
spec = formats[array_format]
primer_5 = 'AGGCTTGGATTTCTATAACTTCGTATAGCATACATTATACGAAGTTAT'
primer_3 = 'ATAACTTCGTATAATGTATGCTATACGAAGTTATCTTGGATTTCTAGA'
scaffold = 'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC'
array_oligos = []
for _, guide in library_df.iterrows():
full_oligo = primer_5 + guide['sequence'] + scaffold + primer_3
if len(full_oligo) > spec['length']:
print(f"Warning: {guide['gene']} oligo too long for {array_format}")
continue
array_oligos.append({
'id': f"{guide['gene']}_{guide['guide_number']}",
'sequence': full_oligo,
'length': len(full_oligo)
})
if len(array_oligos) > spec['capacity']:
print(f"Warning: Library ({len(array_oligos)}) exceeds {array_format} capacity ({spec['capacity']})")
return pd.DataFrame(array_oligos)
array_oligos = design_array_oligos(library, '92K')
array_oligos.to_csv('array_synthesis.csv', index=False)
Library QC
def qc_library(library_df):
'''Quality control checks for library design.'''
qc = {}
qc['total_guides'] = len(library_df)
qc['unique_genes'] = library_df[library_df['type'] == 'targeting']['gene'].nunique()
qc['guides_per_gene'] = library_df[library_df['type'] == 'targeting'].groupby('gene').size().describe()
gc_contents = library_df['sequence'].apply(lambda x: (x.count('G') + x.count('C')) / len(x))
qc['gc_mean'] = gc_contents.mean()
qc['gc_std'] = gc_contents.std()
qc['gc_range'] = (gc_contents.min(), gc_contents.max())
has_poly_t = library_df['sequence'].apply(lambda x: 'TTTT' in x)
qc['poly_t_count'] = has_poly_t.sum()
type_counts = library_df['type'].value_counts()
qc['control_ratio'] = type_counts.get('non-targeting', 0) / len(library_df)
return qc
qc = qc_library(library)
print('Library QC:')
for key, value in qc.items():
print(f' {key}: {value}')
Alternative PAM Systems
The examples above use SpCas9 with NGG PAM. Alternative systems expand targeting range:
| System | PAM | Use Case |
|---|---|---|
| SpCas9 | NGG | Standard, most validated |
| SpCas9-NG | NG | Relaxed PAM requirement |
| SpRY | NRN/NYN | Near-PAMless, broadest targeting |
| Cas12a (Cpf1) | TTTV | AT-rich regions, staggered cuts |
| SaCas9 | NNGRRT | AAV delivery (smaller gene) |
For alternative PAMs, modify the design_sgrnas_for_gene() function:
# Cas12a example (TTTV PAM, 23nt guide)
def design_cas12a_guides(gene_sequence, n_guides=4):
pam_pattern = 'TTT[ACG]' # TTTV
guide_length = 23
for match in re.finditer(f'({pam_pattern})([ACGT]{{{guide_length}}})', gene_sequence):
pam = match.group(1)
guide = match.group(2)
# Cas12a cuts downstream of guide
# ...
Related Skills
- mageck-analysis - Analyze screen results
- crispresso-editing - Validate editing efficiency
- screen-qc - QC sequencing data
- hit-calling - Identify screen hits
Recommended Agent Skills
Expand your agent's capabilities with these related and highly-rated skills.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
agent-ops-spec
Manage specification documents in .agent/specs/. Use when user provides requirements, acceptance criteria, or feature descriptions that need to be tracked and validated against implementation.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-testing
Test strategy, execution, and coverage analysis. Use when designing tests, running test suites, or analyzing test results beyond baseline checks.
agent-ops-state
Maintain .agent state files. Use at session start, after meaningful steps, and before concluding: read/update constitution/memory/focus/issues/baseline consistently.
Didn't find tool you were looking for?